Abstract

DETECTIONS OF SOME RESPIRATORY VIRUSES BY MOLECULAR TECHNIQUES AMONG TWO SUDANESE TARGETS INDIVIDUALS

Ibrahim H. S.*, Kafi S. K., Musa H. A., Karsany M. S. and Abdel Hamid M. M.

Abstract

Background: The term respiratory tract infections (RTIs) are used to describe any infection of the sinuses, throat, airways or lungs. They are usually caused by viruses, bacteria, fungi or even parasites. Common cold is the most widespread RTI. It is the commonest among children due to undeveloped immune system. Rhinovirus, Coxsackie virus, Parainfluenza virus, Human metapneumovirus, are the groups of viruses which infect the URT while Influenza, Human parainfluenza viruses, infect the LRT and Adenovirus, Human respiratory syncytial virus infect both of them. To our knowledge, no reported studies focused solely on the viral causes of respiratory infection among Sudanese patients. This study was therefore conducted to determine incidence of coronaviruses, Rhinovirus and Influenza virus among two groups of Sudanese individuals (patients admitted to Al-shaab Chest Teaching Hospital with respiratory infection and pilgrims arriving Khartoum International Airport from Saudi Arabia). Objective: To detect some of the respiratory viruses using molecular techniques among two targets of Sudanese individuals. Methodology: A total of two hundred individuals (167 patients at Al-shaab Chest Teaching Hospital and 33 pilgrims at the Khartoum International Airport) were included in this study. Sputum samples from both target groups were collected according to microbiologist guide lines instructions for sputum collections & transportations. RNA extraction was done and PCR was done on the products using primer; MERS-CoV orf1*1 Fw: CCACTACTCCCATTTCGTCAG, Rev: CAGTATGTGTAGTGCGCATATAAGCA. MERS-CoV upE Fw: GCAACGCGCGATTCAGTT, Rev: GCCTCTACACGGGACCCATA. Pan-coronavirus*2 Fw: ACWCARHTVAAYYTNAARTAYGC, Rev: TCRCAYTTDGGRTARTCCCA. Influenza A Fw: GACCRATCCTGTCACCTCTGAC, Rev: AGGGCATTYTGGACAAAKCGTCTA. Rhinovirus Fw: TGGACAGGGTGTGAAGAGC, Rev: CAAAGTAGTCGGTCCCATCC. *1 There is another primer was not mentioned here, it just used to confirm our results. *2W=A/T, N=A/C/T/G, R=A/G Analysis was then done using IPM SPSS version 23. Results: The study showed that, the incidences of the tested viruses among the studied group were as follows: Middle East Respiratory Syndrome Coronavirus (MERS-CoV; 83.5%), Influenza A (81.9%), Rhinovirus (16.8%) and Pancoronavirus (11.6%). The rates of infection with each of the tested viruses were higher among the symptomatic patients at Al-shaab Chest Teaching Hospital compared to pilgrims. The infection rate in Al- shaab Chest Teaching Hospital (84.6%) influenza A, (28.8%) Rhinovirus, (12.1%) Pancoronavirus and (86.8%) MERS-CoV while the infection rate at pilgrim was (67.7%) influenza A, (16.1%) Rhinovirus, (9%) Pancoronavirus and (66.6%) MERS-CoV. Conclusion: The study showed that the percentages of individuals with the positive PCR for all tested viruses were higher with MERS-CoV and Influenza A virus. The rate of infection of the studied groups was highest among Al-shaab Teaching Chest Hospital patients rather than those arriving at Khartoum International Airport.

Keywords: MERS-CoV, Influenza, URTIs, LRTIs, URT, LRT.